3.1.3: Making Linearized Backbone PCR Protocol
- Page ID
- 67610
\( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)
\( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)
\( \newcommand{\dsum}{\displaystyle\sum\limits} \)
\( \newcommand{\dint}{\displaystyle\int\limits} \)
\( \newcommand{\dlim}{\displaystyle\lim\limits} \)
\( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)
( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)
\( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)
\( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)
\( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)
\( \newcommand{\Span}{\mathrm{span}}\)
\( \newcommand{\id}{\mathrm{id}}\)
\( \newcommand{\Span}{\mathrm{span}}\)
\( \newcommand{\kernel}{\mathrm{null}\,}\)
\( \newcommand{\range}{\mathrm{range}\,}\)
\( \newcommand{\RealPart}{\mathrm{Re}}\)
\( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)
\( \newcommand{\Argument}{\mathrm{Arg}}\)
\( \newcommand{\norm}[1]{\| #1 \|}\)
\( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)
\( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)
\( \newcommand{\vectorA}[1]{\vec{#1}} % arrow\)
\( \newcommand{\vectorAt}[1]{\vec{\text{#1}}} % arrow\)
\( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)
\( \newcommand{\vectorC}[1]{\textbf{#1}} \)
\( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)
\( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)
\( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)
\( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)
\(\newcommand{\longvect}{\overrightarrow}\)
\( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)
\(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)PCR Protocol for Linearized Backbones
*All procedures copied or modified from iGEM’s linear backbone protocol and Q5® Hot Start High-Fidelity 2X Master Mix Protocol*
- Grow up part BBA_J04450 from the iGem plasmid. Grow 1 part for each different backbone (psB1C3, psB1K3, psB1T3, psB1A3)
- Isolate the DNA from culture and obtain DNA concentration (via DeNovix/Nanodrop/Qubit)
- Make PCR reaction mixture for plasmid amplification using the following table:
*Keep everything on ice and label PCR tubes before starting. Always add the DNA polymerase last as it will sink to the bottom. Use the 50\(\mu L\) reaction for linear backbones. Usually, 1µL of DNA is sufficient. *
| Component | 25 uL Reaction | 50 uL Reaction | Final Concentration |
| Q5 High-Fidelity 2X Master Mix | 12.5 uL | 25 uL | 1X |
| 10 uM Forward Primer (SB-prep-3P-1) | 1.25 uL | 2.5 uL | 0.5 uM |
| 10 uM Reverse Primer (SB-prep-2Ea) | 1.25 uL | 2.5 uL | 0.5 uM |
| Template DNA (psB1C3, A3, K3, T3) | Variable | 10 ng | < 1,000 ng |
| Distilled Water | up to 25 uL | up to 50 uL |
Primers for linear backbone:
SB-prep-3P-1 gccgctgcagtccggcaaaaaa,
SB-prep-2Ea atgaattccagaaatcatccttagcg
4. Place tube in the thermocycler, making sure there are no bubbles and the lids are closed tight
5. Set the thermocycler to the following settings for plasmid amplification:
| Step | Temperature | Time |
| Initial Denaturation | 98°C | 30 seconds |
| 25-35 Cycles | 98°C | 10 seconds |
| 66°C | 30 seconds | |
| 72°C | 3 minutes | |
| Final Extension | 72°C | 1.5 minutes |
| Hold | 4°C |
6. Run 1 uL of the unpurified PCR product on a gel to verify correct band size and concentration
a. psB1C3= 2077 bp
b. psB1A3= 2155 bp
c. psB1K3= 2204 bp
d. psB1T3= 2461 bp
7. Use a PCR cleanup kit to purify the samples (Qiagen or ZymoPure recommended)
8. Test concentration of purified PCR Product (via DeNovix/Nanodrop/Qubit) *Expected yield should be 40 ng/uL or higher
9. Run a digestion with the purified PCR product
- Digestion:
- 4 uL 10X NEB Buffer 2.1
- 1 uL EcoRI-HF
- 1 uL PstI
- 1 uL DpnI (Used to digest any template DNA from production)
- 25 uL PCR Linearized plasmid product (use total amount from purified PCR product)
- Digest at 37°C for 3 hours
- Heat kill at 80°C for 20 minutes
10. PCR purify using the same kit as before, quantify DNA concentration, and adjust final concentration of the plasmid to 25 ng/uL using distilled water
11. Ligate each purified backbone to another plasmid part. Also set-up one control tube for each backbone. (This tube will not have ANY insert added and will just have water added in place. This tests how often the backbone just closes on itself instead of ligating the insert inside).
*Choose a part with a relatively large insert that you know is correct and you have plenty to spare. Digest 300 ng of the plasmid with EcoRI and PstI according to the Double Digestion instruction. Heat inactivate the sample*
- Ligation:
- 1 uL purified E/P digested plasmid backbone (25 ng)
- Equimolar amount of E/P digested fragment (2 uL)
- 1 uL T4 DNA Ligase Buffer
- 0.5 uL T4 DNA Ligase
- Distilled water up to 10 uL
- Ligate at 16°C for 30 minutes
- Heat kill at 80°C for 20 minutes
12. Transform 25 uL of bacteria (JM109 recommended) with 1-2 uL of ligation product
*See “Cell Transformation: Zippy Transformation of Z-competent Cells” protocol above for information on how to perform a transformation*
13. Plate on the appropriate antibiotic plate according to backbone resistance gene
|
Any colonies on the backbone-only control plates represent background to the three antibiotic assembly process. If there are too many, this could present a problem during the student projects. Many colonies on the backbone+insert plates indicate that the backbones are amplified and cut effectively to be ligated to E/P cut inserts. |


