Skip to main content
Biology LibreTexts

3.1.3: Making Linearized Backbone PCR Protocol

  • Page ID
    67610
    • Nathan Reyna, Ruth Plymale, and Kristen Johnson
    • Ouachita Babtist University and University of New Hampshire

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\dsum}{\displaystyle\sum\limits} \)

    \( \newcommand{\dint}{\displaystyle\int\limits} \)

    \( \newcommand{\dlim}{\displaystyle\lim\limits} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \(\newcommand{\longvect}{\overrightarrow}\)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)

    PCR Protocol for Linearized Backbones

    *All procedures copied or modified from iGEM’s linear backbone protocol and Q5® Hot Start High-Fidelity 2X Master Mix Protocol*

    1. Grow up part BBA_J04450 from the iGem plasmid. Grow 1 part for each different backbone (psB1C3, psB1K3, psB1T3, psB1A3)
    2. Isolate the DNA from culture and obtain DNA concentration (via DeNovix/Nanodrop/Qubit)
    3. Make PCR reaction mixture for plasmid amplification using the following table:

    *Keep everything on ice and label PCR tubes before starting. Always add the DNA polymerase last as it will sink to the bottom. Use the 50\(\mu L\) reaction for linear backbones. Usually, 1µL of DNA is sufficient. *

    Component 25 uL Reaction 50 uL Reaction Final Concentration
    Q5 High-Fidelity 2X Master Mix 12.5 uL 25 uL 1X
    10 uM Forward Primer (SB-prep-3P-1) 1.25 uL 2.5 uL 0.5 uM
    10 uM Reverse Primer (SB-prep-2Ea) 1.25 uL 2.5 uL 0.5 uM
    Template DNA (psB1C3, A3, K3, T3) Variable 10 ng < 1,000 ng
    Distilled Water up to 25 uL up to 50 uL

    Primers for linear backbone:

    SB-prep-3P-1 gccgctgcagtccggcaaaaaa,

    SB-prep-2Ea atgaattccagaaatcatccttagcg

    Step Temperature Time
    Initial Denaturation 98°C 30 seconds
    25-35 Cycles 98°C 10 seconds
    66°C 30 seconds
    72°C 3 minutes
    Final Extension 72°C 1.5 minutes
    Hold 4°C
    1. Digestion:
      1. 4 uL 10X NEB Buffer 2.1
      2. 1 uL EcoRI-HF
      3. 1 uL PstI
      4. 1 uL DpnI (Used to digest any template DNA from production)
      5. 25 uL PCR Linearized plasmid product (use total amount from purified PCR product)
      6. Digest at 37°C for 3 hours
      7. Heat kill at 80°C for 20 minutes

    *Choose a part with a relatively large insert that you know is correct and you have plenty to spare. Digest 300 ng of the plasmid with EcoRI and PstI according to the Double Digestion instruction. Heat inactivate the sample*

    1. Ligation:
      1. 1 uL purified E/P digested plasmid backbone (25 ng)
      2. Equimolar amount of E/P digested fragment (2 uL)
      3. 1 uL T4 DNA Ligase Buffer
      4. 0.5 uL T4 DNA Ligase
      5. Distilled water up to 10 uL
      6. Ligate at 16°C for 30 minutes
      7. Heat kill at 80°C for 20 minutes

    *See “Cell Transformation: Zippy Transformation of Z-competent Cells” protocol above for information on how to perform a transformation*

    Any colonies on the backbone-only control plates represent background to the three antibiotic assembly process. If there are too many, this could present a problem during the student projects.

    Many colonies on the backbone+insert plates indicate that the backbones are amplified and cut effectively to be ligated to E/P cut inserts.


    This page titled 3.1.3: Making Linearized Backbone PCR Protocol is shared under a not declared license and was authored, remixed, and/or curated by Nathan Reyna, Ruth Plymale, and Kristen Johnson.

    • Was this article helpful?