Skip to main content
Biology LibreTexts

9: DNA Lab

  • Page ID
    163247
  • \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\dsum}{\displaystyle\sum\limits} \)

    \( \newcommand{\dint}{\displaystyle\int\limits} \)

    \( \newcommand{\dlim}{\displaystyle\lim\limits} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \(\newcommand{\longvect}{\overrightarrow}\)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \(\newcommand{\ket}[1]{\left| #1 \right>}\)
    \(\newcommand{\bra}[1]{\left< #1 \right|}\)
    \(\newcommand{\braket}[2]{\left< #1 \vphantom{#2} \right| \left. #2 \vphantom{#1} \right>}\)
    \(\newcommand{\braopket}[3]{\left< #1 \vphantom{#2}\vphantom{#3} \right| #2 \vphantom{#1}\vphantom{#3} \left| #3 \vphantom{#1}\vphantom{#2} \right>}\)
    \(\newcommand{\qmvec}[1]{\mathbf{\vec{#1}}}\)
    \(\newcommand{\op}[1]{\hat{\mathbf{#1}}}\)
    \(\newcommand{\expect}[1]{\langle #1 \rangle}\)
    \(\newcommand{\dfn}[1]{\emph{\textbf{#1}}}\)

    \(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)

    Purpose:

    This lab explores the structure and function of DNA, as well as techniques to isolate, analyze, and visualize DNA. Students will extract DNA from strawberries, model its structure, and perform DNA fingerprinting to understand its applications in science and forensics.

    Tasks:

    1. Extract DNA from a plant or animal source and observe its properties.
    2. Construct a physical model of the DNA molecule to learn its structure.
    3. Simulate DNA fingerprinting using restriction enzymes and gel electrophoresis to identify relationships.

    Criteria for Success:

    • Successfully extract DNA and explain the significance of each step.
    • Accurately build a DNA model and label its components.
    • Analyze DNA fingerprinting data to draw correct conclusions.

    Simplified Timeline for DNA Lab

    • Introduction and Setup (15 minutes): Overview of DNA structure and lab objectives.
    • DNA Extraction (20 minutes): Perform and observe extraction from strawberries.
    • DNA Modeling (20 minutes): Construct and label the DNA model.
    • DNA Fingerprinting (25 minutes): Cut and analyze DNA fragments to determine relationships.
    • Data Compilation and Discussion (15 minutes): Share results, answer questions, and clean up.

    Introduction to DNA

    Deoxyribonucleic acid (DNA) is located in the nucleus of eukaryotic cells (animals, plants, fungi, and protists). DNA contains information to direct the cell in the manufacture of proteins. Proteins control development, organ function, metabolism, enzymatic reactions, photosynthesis, muscle action, brain activity, and many other cellular processes. DNA is often referred to as the “blueprint for life”.

    DNA is a polymer composed of repeating monomers, called nucleotides. Each nucleotide has three basic parts. The first is nucleotide bases (one of guanine (G), adenine (A), thymine (T), or cytosine (C)) a deoxyribose sugar and a phosphate group. These monomers are assembled with the sugar/phosphates making the backbone of the strands and the ATCG bases connect the two strands (Fig. 1). The two DNA strands then twist because of hydrogen bonding of the two backbones to form a double helix.

    When DNA winds tightly around histone proteins, it forms thread-like structures called chromosomes. Cells of eukaryotic organisms contain multiple linear chromosomes. Prokaryotic organisms, such as single-celled bacteria like Escherichia coli (E. coli), contain a single circular chromosome.

    A gene is a sequence of nucleotide bases found on a strand of DNA that codes for a specific protein. Every living thing has genes that code for proteins, but different species have varying numbers of genes. Human DNA, for example, contains about 20,000 genes, while the cells of the rice plant contain over 40,000 genes. The 3 billion nucleotide base pairs in the human genome are located on 46 chromosomes. The Human Genome Project has determined the order of the nucleotides on each chromosome, and thus the location of each gene. Despite the differences between the structure and number of chromosomes and genes in organisms, the DNA functions the same way in all organisms to encode proteins


    1uujk7UqICyapVjwPtiFdcqIVh-uebsBlBD0pmydY6_1w126XFVWZ6ncf8HGsmUAEWKXPgJFQ_c00MEhXKWkwPImMi_6OdvBOFIY7ZdC-1JhA2JhDgT8gzpDZmQh23lc_Mnd3Oy6
    Figure 1. DNA Structure. (“Madprime (talk · contribs), Madeleine Price Ball, CC0, via Wikimedia Commons”

    Lab Safety

    Safety Guidelines for Handling Chemicals and Biological Samples:

    1. Wear gloves and goggles when working with biological samples and ethanol.
    2. Avoid vigorous mixing when adding ethanol to prevent disrupting DNA precipitation.
    3. Dispose of biological waste, including cheesecloth, in designated waste containers.
    4. Clean all reusable equipment thoroughly after the lab.

    Suggested Student Roles and Group Size

    For groups of 3 students:

    1. Extraction Specialist: Prepares and carries out the DNA extraction steps. Cuts out restriction enzyme paper.
    2. Model Builder and Materials Manager: Constructs and labels the DNA model. Organize and clean supplies.
    3. Data Recorder/Analyzer: Records DNA fragment data and interprets results

    Exercise 1: DNA EXTRACTION

    The first step in working with DNA is to remove the molecules from inside the cell. Different types of cells need to be processed differently to release nucleic acids. All cells have a cell membrane made of a phospholipid bilayer that separates the internal environment of the cell from the external environment. In eukaryotic cells, DNA is housed inside the nucleus of the cell which is surrounded by the nuclear membrane which is a second double-layered membrane, also composed largely of lipid molecules. When extracting DNA from plant cells, the cell wall made of cellulose must also be considered; some types of plant tissue require grinding or flash-freezing to break the tough cell wall.

    In the DNA isolation procedure, plant cell walls and cell membranes are broken down by blending or mashing and heating the cells. Detergent in the extraction solution dissolves phospholipids in the cell membrane causing the cells to lyse. When cells undergo lysis, the cellular components, including the DNA, are released. The technique of filtration uses a medium, in this case, cheesecloth, to separate solids from liquids. The resultant material is referred to as filtrate. When cold ethanol is added to the filtrate, DNA precipitates at the water/ethanol interface. Although an individual DNA molecule is not visible with the naked eye, DNA isolated from large quantities of cells can be observed.

    Strawberry fruit tissue is an excellent type of tissue to use for the demonstration of DNA extraction. First, ripe strawberries are soft and juicy; as the fruit matures, the cells fill up with water and sugar. Second, as the strawberry ripens, a series of chemical reactions take place within the cells that lead to the breakdown of long-chain polysaccharides, like cellulose and pectin, causing the cell wall to become less tough. Lastly, cultivated strawberries (Fragaria x ananassa) are the product of a hybridization between two other strawberry species, and they have an octoploid genome, meaning they have eight sets of chromosomes (Fig. 2) inside their cells and just under 1 billion DNA base pairs. Similarly, wheat (Triticum aestivum) is hexaploid but is likely the product of several hybridization events between three different related species and contains about 17 billion DNA base pairings! These translate to lots of molecules of DNA, which increases our yield and makes the DNA easier to visualize

    4moy52-gthENw5lZBj5nnPv2Yql7O0_RuT1JwR2jZMdeymcXSkClXdqk3dmrkE_LGOEYRNFnTc9mIO9gCFKvS9XYo6MxYtqlr8CcCmuLmMBVuoJhtHompY7po3uJe3sO4965n_79
    Figure 2. Image of strawberry chromosomes; Strawberries (Fragaria x ananassa) are octoploid (8N) N=number of chromosomes in one set. (image: https://bmcplantbiol.biomedcentral.com/articles/10.1186/1471-2229-11-157 CCBY)

    Materials:

    Equipment Materials
    Graduated cylinders Isopropyl alcohol 91% (rubbing alcohol) or 95% ethanol, Chilled in the freezer
    Cheesecloth Salt
    Glass test tubes DI Water
    Funnel Dishwashing liquid (preferably, Dawn)
    Disposable plastic drinking cups A DNA source (about 1 cubic inch of food)
    Microcentrifuge tubes strawberries
    Wooden stirrer or glass rod bananas
    Resealable plastic bag ground flax seed
    100 or 200 mL beaker ground wheat germ
    Ice buckets with ice peas
      broccoli
      spinach

    Preparation

    • Have isopropyl alcohol (rubbing alcohol) or ethanol cooled in an ice bucket
    • Prepare your food item if needed (i.e. remove green strawberry tops, peel banana, grind wheat germ, etc)
    • If not already made, prepare DNA extraction (lysis) buffer by combining the following:
      • 45 mL DI water
      • 5mL liquid dish soap
      • 0.75 g NaCl (table salt)

    Notes

    • The success of extraction can be verified by microscopic examination
    • Avoid vigorous mixing after adding alcohol, as this will disrupt DNA precipitation
    • If DNA strands are not visible, allow the tube to stand undisturbed for 5-10 minutes

    Procedure

    1. Place the food item (i.e 2 large strawberries) into the plastic zipper bag. Seal it and gently smash the food with your hands for about 2 minutes. Completely crush the food (strawberries) to disrupt the cells.
    2. Open the plastic zipper bag and add 10mL of the DNA extraction (lysis) buffer. Squeeze the bag to remove all air and seal the bag tightly.
    3. Gently (to prevent excessive foaming), but thoroughly, continue to crush the food (strawberries) inside the bag for about one minute or until it is a slushy consistency.
    4. Completely line the funnel with a layer of cheesecloth. Place the funnel into the wide-mouth test tube.
    5. Pour the food juice/DNA extraction buffer mixture into the funnel so the juice passes through the cheesecloth and into the test tube. Use the cheesecloth to strain the mixture so that only the juice flows into the tube and the pulp is retained in the cheesecloth.
    6. Discard the cheesecloth and the pulp. Remove the funnel from the tube. The glass tube now contains a liquid called “filtrate”.
    7. Carefully and slowly pipette an equal volume of ice-cold ethanol on top of the filtrate in the test tube using the plastic transfer pipette. The alcohol is less dense than the filtrate and will float as a layer on top of the filtrate. Do not mix or stir
    8. Hold the tube still at eye level and observe what happens at the interface of the alcohol and the filtrate. DNA will precipitate at the alcohol-lysis buffer interface. This means it will come out of solution into a “solid” form and appear as fluffy white cotton or cloudy material. Verify with your instructor that you have isolated DNA.
    9. (optional) Use your wooden stirrer or glass rod to transfer your extracted DNA into a microcentrifuge tube. Add a small amount of ethanol to the tube to prevent your DNA from drying out.
    Alternative: cheek Cell DNA Extraction Protocol

    Materials

    Equipment Materials
    Graduated cylinders Isopropyl alcohol 91% (rubbing alcohol) or 95% ethanol, Chilled in the freezer
    Cheesecloth Salt (NaCl)
    Wide-mouth glass test tubes DI Water
    Funnel Dishwashing liquid (preferably, Dawn)
    Plastic cups (for collecting sample) Shaker of salt (food type, not lab-grade salt)
    Microcentrifuge tubes  
    Wooden stirrer or glass rod  
    Resealable plastic bag  
    100 or 200 mL beaker  
    Ice buckets with ice  
    Small bottles of drinking water or clean and sealed drinking cups  

    Preparation

    1. Chill isopropyl alcohol in an ice bucket
    2. Prepare DNA extraction (lysis) buffer:

    ○ 45 mL DI water

    ○ 5 mL liquid dish soap

    ○ 0.75 g NaCl (table salt)

    Procedure

    Sample Collection- Your instructor may have special instructions for this because of food/beverage restrictions in the lab space.

    1. Rinse mouth thoroughly with drinking water
      1. Use only non-lab water for this extraction
      2. Either bottled water or water from a drinking fountain
    2. Using your clean drinking cup, add one shake of salt from the salt shaker and vigorously swish for 30 seconds to collect cheek cells
    3. Carefully expel the solution into a fresh, clean plastic cup
    4. Repeat the saline rinse two more times, collecting all samples in the same cup

    DNA Extraction

    1. Transfer the collected sample to a clean test tube to fill it about half full.
    2. Add 10 mL of the DNA extraction (lysis) buffer to the test tube
    3. Gently swirl the mixture for 2 minutes to lyse the cells
    4. Line a funnel with a layer of cheesecloth and place it in a clean wide-mouth test tube
    5. Very slowly and carefully layer an equal volume of ice-cold ethanol down the side of the tube containing the filtrate. If done correctly, the alcohol will form a layer on top of the extract.
    6. Hold the tube still and observe the interface between the alcohol and filtrate layers
    7. DNA will precipitate at the interface as white, thread-like strands. Leave stand for at least 10 minutes.

    Optional: Use a wooden stirrer or glass rod to carefully collect the DNA strands and transfer them to a microcentrifuge tube containing a small amount of ethanol for preservation.

    Disposal

    • All biological materials should be disposed of in appropriate biohazard containers
    • Used cheesecloth and other materials that contacted biological samples should be properly disposed of according to laboratory protocols
    • Thoroughly clean all reusable equipment according to laboratory protocols

    Discussion

    This protocol for the extraction of DNA is based largely on the principle of solubility. Solubility refers to the ability of one substance (the solute) to dissolve in another substance (the solvent). Recall that polar substances dissolve easily in polar solvents, but do not dissolve easily in nonpolar solvents, a phenomenon commonly referred to as “like dissolves like.” Water is a polar solvent, and molecules that dissolve easily in water are referred to as hydrophilic. DNA molecules are hydrophilic because the sugar-phosphate backbone of the molecules is highly polar. This means that DNA dissolves in water, so in this experiment, the DNA that is released when the cells are crushed dissolves in the juice/extraction buffer mixture.

    Remember, there are two key ingredients in the DNA extraction buffer aside from the water: dish soap and salt. The dish soap acts to break up the phospholipid molecules that form the cell membrane and the nuclear membrane, which lyses the cell and releases the cellular contents, including DNA. The salt has two functions in the extraction process. It helps to neutralize the charge on the sugar-phosphate backbone, making DNA less soluble in water and allowing it to more easily precipitate when the alcohol is added. The salt also helps to remove the proteins that are bound to the DNA and to keep the proteins dissolved in the lysis solution.

    Although the chemical reactions described above are all happening when you add the buffer and crush the food (strawberries), they are not visible with the naked eye. However, the addition of the cold ethanol caused a much more dramatic result. Ethanol is a nonpolar solvent, and when it is added to the juice extract, the DNA precipitates out of the solution. A precipitation reaction is a chemical reaction that causes a solid substance to emerge from a liquid solution. In this experiment, the addition of ethanol to the reaction forces the DNA to precipitate out of the solution, which we can then spool onto the wooden stirrer or glass rod.

    Exercise 2: Modeling of DNA Structure

    The DNA molecule is a complex, yet simple molecule. Only four different nucleotide building blocks (adenine, thymine, guanine and cytosine) are used to form the DNA sequences that encode for all of the proteins in our bodies. Each nucleotide has three components: a negatively charged phosphate molecule, a deoxyribose sugar and a nitrogenous base (Fig. 3). On each strand of DNA the phosphate and deoxyribose sugar are arranged on the outside of the DNA molecule, forming a “backbone.” The nitrogenous bases are positioned in the interior of the double helix.

    Each strand of DNA is complementary to the other, meaning that the nitrogenous bases of the two strands are always paired in specific combinations, called base pairing. If there is an adenine in one strand, then it is paired and directly across from a thymine in the other strand. If there is a cytosine in one strand then it is paired with a guanine in the other strand. Therefore, if you know the sequence of one of the strands of DNA, then you can deduce the sequence of the opposite (complementary) strand. Hydrogen bonds between the nitrogenous bases hold the two strands of DNA together.

    The DNA strands also have directionality, referred to as the 5’ (5 prime) and 3’ (3 prime) ends. When looking at a strand of DNA, the end that has a free phosphate group is the 5’ end. The end of the DNA strand that has a free -OH group on the 3’ carbon of the deoxyribose sugar is referred to as the 3’ end (see Fig. 1). The two DNA strands are antiparallel to one another, running in opposite directions like opposite lanes of a street.

    T0991jheaUbuBgCX-5TTVbMTfdn8rZOPUqlaXtc2VswcrDE-isZzDAWudqEZwWDUD8JgHDpL-GtdtB5QFGgyKQqsU_j1Ku6qa0sZVg9JAJHSffmyyoS1c2M_tMCjQUffCUFqmR1t
    Figure 3. DNA and nucleotide structure. (CC BY 4.0; OpenStax via Wikimedia Commons.)

    Materials:

    We will utilize the Carolina BioKits: DNA Simulation Kit. (Your instructor may provide you with an alternative DNA Simulation Kit and instructions. A simple modeling activity using candy is discussed here.)

    The Carolina DNA modeling kit uses different colored components to represent the phosphate group, deoxyribose sugar, and the four different nitrogenous bases. You will use these to build thymine, adenine, guanine, and cytosine nucleotides. Then, you will link the individual nucleotides together to “build” a strand of DNA.

    Procedure:

    1. Follow the directions provided with the DNA simulation kit.
    2. When finished, verify your model with the instructor.
    3. Insert a picture of your completed model here:

    Exercise 3: DNA Fingerprinting

    DNA fingerprinting is routinely used today to establish paternity, diagnose inherited disorders, and use in criminal cases. DNA fingerprinting enables forensic investigators to determine whether two DNA samples originate from the same individual. Not all of the DNA present in a sample is used in an analysis. Restriction enzymes act as molecular scissors and are used to cleave DNA molecules at specific sequences of DNA. Over 2,500 different restriction enzymes have been identified.

    These enzymes are produced naturally by bacteria and are used as a defense to destroy foreign DNA such as bacteriophages (viruses that infect bacteria). Each restriction enzyme cleaves DNA at a specific nucleotide sequence. For example, the restriction enzyme EcoR1, isolated from E. coli, cuts DNA at the sequence GAATTC (Fig. 4).

    clipboard_eda8f20d98dc1bdedcd4c8d159bc77ea2.png

    Figure 4. Recognition sequence of EcoRl.

    When these enzymes are used by scientists, the length and the number of the fragments produced depend upon the frequency and the distance between the recognition sites. For example, if a restriction enzyme cuts a sample of DNA 6 times, there would be 7 fragments. The size of these fragments will vary depending on the distance between cuts.

    The distinct pattern of fragments that results from this type of digest are known as restriction fragment length polymorphisms (RFLP’s) which are unique to each individual, therefore forming a DNA fingerprint.

    After DNA sample(s) is cut by restriction enzymes, the fragments are separated using a technique known as gel electrophoresis. In cases where only trace amounts of DNA can be collected, a process known as polymerase chain reaction (PCR) can also be used to duplicate and multiply a sample to levels that can be analyzed using restriction enzymes. The odds of a false match from a typical human DNA fingerprint analysis is about 1 out of one billion or better.

    Figure 5 shows a typical result of DNA electrophoresis in regard to the size of DNA fragments and the distance migrated through the agarose gel. On the left, there is a marker sample that can be used as a control and as a reference for the length of the DNA (in base pairs). To the right of the marker, there are three examples of different DNA samples: Sample A, Sample B and Sample C. The image displays how smaller DNA fragments move farther throughout the agarose gel than the larger fragments of DNA. These distances can be used to identify or match specific DNA sequences..

    clipboard_e3796f9656526673945b6b58300f3f9eb.png
    Figure 5. Gel electrophoresis (Mckenzielower, CC BY 4.0 <https://creativecommons.org/licenses/by-sa/4.0>, via Wikimedia Commons)

    Materials

    • Color printed DNA sequences from Figure 6
    • Highlighter
    • Scissors

    Procedure:

    You will use DNA fingerprinting technology to determine which male dog is the real father of a puppy, Willy. DNA sequences from each dog are on the next page. In this DNA fingerprinting scenario, the restriction enzyme, Haelll, will be used to digest each DNA sequence. The recognition sequence and cut site of Haelll is shown below (Fig. 5).

    clipboard_ed3ff850ef0f660d8cc2c1b3e46215574.png
    clipboard_e4232928df6fab52e785e6ff30752c063.pngclipboard_e22287d0c48fe5dcb9cb3b5da7043c004.png

    Figure \(\PageIndex{6}\): Recognition sequence of Haelll

    1. Cut the DNA sequence paper from Figure 6 into strips to separate the DNA sequences of each dog into one long strip. You will have 5 strips of DNA sequences (one for each dog).
    2. Identify all GGCC sequences of DNA for the Haelll enzyme to cut. There may be more than one Haelll sequence in the sample sequences. Be sure to scan the entirety of each DNA sequence. When you find the recognition sequence, use a highlighter to highlight the recognition sequence.
      1. Note: a GGCC sequence will be on one strand and CCGG will be mirrored on the opposing strand. This is one recognition sequence that will be cut once.
    3. At each recognition site, use a pencil to draw a vertical line between both strands of DNA to indicate exactly where the restriction enzyme will cut the DNA, separating it into 2 pieces (refer to Fig. 5).
    4. Use scissors to cut the DNA sequences at the indicated restriction sites you marked.
    5. Count the number of nucleotides on one strand of each resulting fragment of DNA. Write the nucleotide length on each fragment.
    6. For each dog, arrange the DNA fragments from largest to smallest to simulate how they would separate when analyzed via gel electrophoresis. Record those DNA fragment sizes in the table below
    Table 1. Restriction fragments from DNA fingerprinting
    Length of DNA fragment
    (base pairs)
    Marker Mother Willy Sire X Sire Y SireX  
      clipboard_e10fea6f95470455176e84ae1f4997966.png clipboard_e10fea6f95470455176e84ae1f4997966.png clipboard_e10fea6f95470455176e84ae1f4997966.png clipboard_e10fea6f95470455176e84ae1f4997966.png clipboard_e10fea6f95470455176e84ae1f4997966.png clipboard_e10fea6f95470455176e84ae1f4997966.png clipboard_e10fea6f95470455176e84ae1f4997966.png

    500 bp

    clipboard_e19a28709b90ddde7064742f64159090a.png            

    250 bp

    clipboard_e19a28709b90ddde7064742f64159090a.png            

    100 bp

    clipboard_e36ceba8e042863f2de17a6f6068c9c45.png            

    75 bp

    clipboard_e36ceba8e042863f2de17a6f6068c9c45.png            

    50 bp

    clipboard_e36ceba8e042863f2de17a6f6068c9c45.png            

    25 bp

    clipboard_e9c772b4ce39052583d4531f0872c284f.png            

    20 bp

    clipboard_e24e15dcb8feecd3ecc02f86d765db784.png            

    15 bp

    clipboard_e5d973f6d6b6dcd29b6c348e0dada216c.png            

    10 bp

    clipboard_eefd3023c24f0d9de83504a8a86f38c80.png            

    5 bp

    clipboard_ef224706c561b03b859c07efffbd8ea3d.png            
    1. Compare the DNA fragments from Willy to the DNA fragments of the Mom and possible fathers. Every fragment in Willy’s digest will be found in either the Mom or Sire’s digest. This comparison will identify the real sire of Willy.
    clipboard_ec28f65ab11342492be89fab8d01ab0f7.png
    Figure 6. DNA sequences to be used for DNA fingerprinting

    Questions for Review

    1. How well do you understand the necessity of each step in the DNA extraction procedure? Match each of the procedures below with its function, by placing the appropriate letter on the line provided.


    1. Briefly describe what precipitation means. Why was this step necessary?

    1. Relate what you know about the chemical structure of DNA to what you observed during the precipitation step.


    1. Briefly explain why strawberry fruit tissue is a great source for extracting DNA.

    1. Why is it important for scientists to be able to extract DNA from living organisms? State at least 2 reasons.
    1. What is the function of genomic DNA and where is it found in a eukaryotic cell?
    1. You are given the DNA sequence below. Using the base-pairing rules, draw the complementary DNA strand in the space below. Make sure to designate the 5’ and 3’ ends appropriately.

    5’ - ATTCGCTCG - 3’



    1. Why might DNA fingerprinting be more useful in identifying individuals than blood typing analysis?

    1. What are the building blocks that compose DNA? What are the three specific components that make up these building blocks?
    1. DNA sequences contain palindromes. Briefly explain what a palindrome is in DNA and give an example.
    1. What biological molecules, which are isolated from different types of bacteria, act as molecular scissors to cut DNA at specific locations? What advantage do you think bacteria gain by having these particular molecules?

    Practical Challenge Questions

    1. For the DNA sequence shown below, use the base-pairing rules to draw the complementary DNA sequence. Be sure to designate the polarity of the resulting strand.

    5’ ATATCATGGAATTCGATCCTAG 3’



    1. Now, “digest” your DNA molecule using EcoRl enzyme. The EcoRl recognition sequence is shown below. Draw a vertical line in your DNA sequence above to indicate specifically where the restriction enzyme would cleave the DNA.





    References

    Belwood, Jacqueline; Rogers, Brandy; and Christian, Jason. Foundations of Biology Lab Manual (Georgia Highlands College). “Lab Activity: DNA Extraction from Strawberries,” (2019). Biological Sciences Open Textbooks. 18. CC-BY

    https://oer.galileo.usg.edu/biology-textbooks/18

    Natale, E. G., Laura Blinderman, &. Patrick. (2021, March 19). Book: Unfolding the Mystery of Life - Biology Lab Manual for Non-Science Majors (Genovesi, Blinderman & Natale). “Lab Exercise 11: Isolation of DNA from Plants.” CC-BY Retrieved April 5, 2021, from https://bio.libretexts.org/@go/page/24114

    Sanver-Wang, Dilek. College of the Canyons, General Biology BioSci100 Laboratory Manual, Building Knowledge through Experiments 4th Edition. “Lab 9: Analysis of DNA.” CC-BY.

    Alignment with Program Competencies

    LabTask

    SLO/Competency Alignment

    Extracting and observing DNA

    Develops technical lab skills

    Modeling DNA structure

    Demonstrates understanding of biological macromolecules

    DNA fingerprinting analysis

    Applies critical thinking and data analysis


    This page titled 9: DNA Lab was last modified on Sat, 28 Jun 2025 19:17:46 GMT and is shared under a CC BY 4.0 license and was authored, remixed, and/or curated by Brad Basehore, Michelle A. Bucks, and Christine M. Mummert via source content that was edited to the style and standards of the LibreTexts platform.