Skip to main content
Biology LibreTexts

16.4: In Silico PCR

  • Page ID
    24918
  • \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \) \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)\(\newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\) \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\) \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\) \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\) \( \newcommand{\Span}{\mathrm{span}}\) \(\newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\) \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\) \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\) \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\) \( \newcommand{\Span}{\mathrm{span}}\)\(\newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    Using the primer sequences, one can determine the size and/or location of a PCR product. This can be done using BLAST or with a program like UGENE.

    Using BLAST

    1. Primers for the PV92 insertion.
      • Forward primer: 5′ GGATCTCAGGGTGGGTGGCAATGCT 3′
      • Reverse primer: 5′ GAAAGGCAAGCTACCAGAAGCCCCAA 3′
    2. Visit BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch.
    3. Paste both primers:
      • GGATCTCAGGGTGGGTGGCAATGCTGAAAGGCAAGCTACCAGAAGCCCCAA
      • Remove the 5′ and 3′ numbers.
    4. Choose “Somewhat Similar”.
      • Locate the locus of the product and the size.

    Using Ugene

    1. Exercise using a human D-Loop Primers.
      • Forward Primer 5’-TTAACTCCACCATTAGCACC-3’
      • Reverse Primer 5’-GAGGATGGTGGTCAAGGGAC-3’
    2. Download the sample Genbank file: Human Mitochondrial Genome.
    3. Open the file in Ugene.
    4. Select the “In Silico PCR” button on the far right (double helix button).
      • Insert forward and reverse primers in the appropriate spaces.

    primerbutton

    5. A PCR product should be noted for one of the sequences after pressing “Find Products anyway“.


    This page titled 16.4: In Silico PCR is shared under a CC BY-NC-SA 4.0 license and was authored, remixed, and/or curated by Bio-OER.

    • Was this article helpful?