Search

Text Color

Margin Size

Font Type

Enable Dyslexic Font

16.1: Introduction

Last updated

Jan 3, 2021
Save as PDF
- 16: Bioinformatics
- 16.2: Sequence Analysis

$\newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} }$

$\newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}}$

$\newcommand{\id}{\mathrm{id}}$ $\newcommand{\Span}{\mathrm{span}}$

( \newcommand{\kernel}{\mathrm{null}\,}\) $\newcommand{\range}{\mathrm{range}\,}$

$\newcommand{\RealPart}{\mathrm{Re}}$ $\newcommand{\ImaginaryPart}{\mathrm{Im}}$

$\newcommand{\Argument}{\mathrm{Arg}}$ $\newcommand{\norm}[1]{\| #1 \|}$

$\newcommand{\inner}[2]{\langle #1, #2 \rangle}$

$\newcommand{\Span}{\mathrm{span}}$

$\newcommand{\id}{\mathrm{id}}$

$\newcommand{\Span}{\mathrm{span}}$

$\newcommand{\kernel}{\mathrm{null}\,}$

$\newcommand{\range}{\mathrm{range}\,}$

$\newcommand{\RealPart}{\mathrm{Re}}$

$\newcommand{\ImaginaryPart}{\mathrm{Im}}$

$\newcommand{\Argument}{\mathrm{Arg}}$

$\newcommand{\norm}[1]{\| #1 \|}$

$\newcommand{\inner}[2]{\langle #1, #2 \rangle}$

$\newcommand{\Span}{\mathrm{span}}$ $\newcommand{\AA}{\unicode[.8,0]{x212B}}$

$\newcommand{\vectorA}[1]{\vec{#1}} % arrow$

$\newcommand{\vectorAt}[1]{\vec{\text{#1}}} % arrow$

$\newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} }$

$\newcommand{\vectorC}[1]{\textbf{#1}}$

$\newcommand{\vectorD}[1]{\overrightarrow{#1}}$

$\newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}}$

$\newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}}$

$\newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} }$

$\newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}}$

$\newcommand{\avec}{\mathbf a}$

$\newcommand{\bvec}{\mathbf b}$

$\newcommand{\cvec}{\mathbf c}$

$\newcommand{\dvec}{\mathbf d}$

$\newcommand{\dtil}{\widetilde{\mathbf d}}$

$\newcommand{\evec}{\mathbf e}$

$\newcommand{\fvec}{\mathbf f}$

$\newcommand{\nvec}{\mathbf n}$

$\newcommand{\pvec}{\mathbf p}$

$\newcommand{\qvec}{\mathbf q}$

$\newcommand{\svec}{\mathbf s}$

$\newcommand{\tvec}{\mathbf t}$

$\newcommand{\uvec}{\mathbf u}$

$\newcommand{\vvec}{\mathbf v}$

$\newcommand{\wvec}{\mathbf w}$

$\newcommand{\xvec}{\mathbf x}$

$\newcommand{\yvec}{\mathbf y}$

$\newcommand{\zvec}{\mathbf z}$

$\newcommand{\rvec}{\mathbf r}$

$\newcommand{\mvec}{\mathbf m}$

$\newcommand{\zerovec}{\mathbf 0}$

$\newcommand{\onevec}{\mathbf 1}$

$\newcommand{\real}{\mathbb R}$

$\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}$

$\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}$

$\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}$

$\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}$

$\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}$

$\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}$

$\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}$

$\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}$

$\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}$

$\newcommand{\laspan}[1]{\text{Span}\{#1\}}$

$\newcommand{\bcal}{\cal B}$

$\newcommand{\ccal}{\cal C}$

$\newcommand{\scal}{\cal S}$

$\newcommand{\wcal}{\cal W}$

$\newcommand{\ecal}{\cal E}$

$\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}$

$\newcommand{\gray}[1]{\color{gray}{#1}}$

$\newcommand{\lgray}[1]{\color{lightgray}{#1}}$

$\newcommand{\rank}{\operatorname{rank}}$

$\newcommand{\row}{\text{Row}}$

$\newcommand{\col}{\text{Col}}$

$\renewcommand{\row}{\text{Row}}$

$\newcommand{\nul}{\text{Nul}}$

$\newcommand{\var}{\text{Var}}$

$\newcommand{\corr}{\text{corr}}$

$\newcommand{\len}[1]{\left|#1\right|}$

$\newcommand{\bbar}{\overline{\bvec}}$

$\newcommand{\bhat}{\widehat{\bvec}}$

$\newcommand{\bperp}{\bvec^\perp}$

$\newcommand{\xhat}{\widehat{\xvec}}$

$\newcommand{\vhat}{\widehat{\vvec}}$

$\newcommand{\uhat}{\widehat{\uvec}}$

$\newcommand{\what}{\widehat{\wvec}}$

$\newcommand{\Sighat}{\widehat{\Sigma}}$

$\newcommand{\lt}{<}$

$\newcommand{\gt}{>}$

$\newcommand{\amp}{&}$

$\definecolor{fillinmathshade}{gray}{0.9}$

FASTA Format

Biological sequences are passed to software in a standardized format referred to as FASTA. FASTA is a plain text format that can be read in any text editor (TextEdit, Notepad, VIM, TextWrangler, etc.). Nucleic acids (DNA and RNA) and Proteins are represented by single-letter nucleotides (A, T, C, G) or single letter amino acid (20 amino acids). FASTA sequences begin with a > character in the first line followed by some descriptive information about the sequence, like a sequence name. The next line consists of the sequence information. A FASTA file can contain multiple sequence entries all demarcated by a new line and a title line beginning with >.

Example FASTA File

> Made-up nucleic acid sequence
ATATAGGGATTAGGATTAGAGGATAGAGGGGATTGCGCCG
> Another nucleic acid sequence in the same file
GGGTCGGGCTAGCGGAATCGGATTCGGCATTCGGATATTCGGATTCGGAT

FASTA files are plain text but usually have an extension indicating it as a sequence file: .fasta, .fa, .fna or even .txt

A list of single-letter codes for nucleic acids follows below:

Nucleic Acid Code	Meaning	Mnemonic
A	A	Adenine
C	C	Cytosine
G	G	Guanine
T	T	Thymine
U	U	Uracil
R	A or G	puRine
Y	C, T, or U	pYrimidines
K	G, T, or U	bases which are Ketones
M	A or C	bases with aMino groups
S	C or G	Strong interaction
W	A, T, or U	Weak interaction
B	not A (i.e. C, G, T, or U)	B comes after A
D	not C (i.e. A, G, T, or U)	D comes after C
H	not G (i.e., A, C, T, or U)	H comes after G
V	neither T nor U (i.e. A, C, or G)	V comes after U
N	A, C, G, T, U	Nucleotide
X	masked
–	Gap of indeterminate length

Graphical Sequence Manipulation

The exercises described here regarding bioinformatics will utilize a free and open-source software called Unipro UGENE.

Okonechnikov K, Golosova O, Fursov M, the UGENE team. Unipro UGENE: a unified bioinformatics toolkit.Bioinformatics 2012 28: 1166-1167. doi:10.1093/bioinformatics/bts09
Golosova O, Henderson R, Vaskin Y, Gabrielian A, Grekhov G, Nagarajan V, Oler AJ, Quiñones M, Hurt D, Fursov M, Huyen Y.Unipro UGENE NGS pipelines and components for variant calling, RNA-seq, and ChIP-seq data analyses. PeerJ 2014 2:e644. doi:10.7717/peerj.644

FASTA Format

Example FASTA File

Graphical Sequence Manipulation

Support Center

How can we help?