13.2: Barcoding (Activity)
- Page ID
- 24863
\( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \) \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)\(\newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\) \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\) \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\) \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\) \( \newcommand{\Span}{\mathrm{span}}\) \(\newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\) \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\) \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\) \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\) \( \newcommand{\Span}{\mathrm{span}}\)\(\newcommand{\AA}{\unicode[.8,0]{x212B}}\)
DNA Barcoding of Samples
- Place sample in a clean 1.5 mL tube.
- Add 100 μl of nuclear lysis solution to tube.
- Twist a clean plastic pestle against the inner surface.
- Add 500 μl more nuclear lysis solution to tube.
- Incubate the tube in a water bath or heat block at 65°C for 5-15 minutes.
- [Optional] Add 200 μl of protein precipitation solution to each tube incubate on ice for 5 minutes.
- Centrifuge for 4 minutes at maximum speed to pellet protein and cell debris.
- Transfer 600 μl of supernatant to a clean labeled tube.
- Add 600 μl of isopropanol.
- Centrifuge for 2 minutes at maximum speed to pellet the DNA.
- Pour off the supernatant and add 600 μl of 70% ethanol to wash the pellet.
- Centrifuge the tube for 2 minutes at maximum speed and carefully remove the solution.
- Air-dry the pellet for 10 minutes and add 100 μl of the DNA rehydration solution (TE).
- Incubate the DNA at 65°C for 5-10 minutes to dissolve.
- Obtain a PCR tube containing Ready-To-Go PCR Bead. Label the tube with your identification number.
- Use a micropipette with a fresh tip to add 23 μL of one of the following primer/loading dye mixes to each tube. Allow the beads to dissolve for 1 minute.
- Plants: rbcL primers (rbcLaF / rbcLa rev)
- Fish: COI primers (VF2_t1/ FishF2_t1/ FishR2_t1/ FR1d_t1)
- Insects: (LepF1_t1/ LepR1_t1)
- Add 2 μl of your DNA directly into the appropriate primer/loading dye mix.
- Place tubes in a Thermal cycler.
- Pour 2% agarose into casting apparatus in the refrigerator.
- 2 gels per class needed to be made → 100ml of TBE with 2g agarose
- Add 5 μl SYBR safe solution into the molten agarose before casting.
- Place 2 sets of combs into the gel → at one end and in the middle.
- Load DNA ladder and PCR samples.
- Run the gel at 120V for 30 minutes.
- Visualize on the UV transilluminator.
- Document with a camera.
- Send amplicons of verified samples for sequencing.
- Plant rbcL gene
- rbcLaf 5’- ATGTCACCACAAACAGAGACTAAAGC-3’ (forward primer)
- rbcLar 5’- GTAAAATCAAGTCCACCRCG-3’ (reverse primer)
- Animal coi gene
- lepF1 5’- ATTCAACCAATCATAAAGATATTGG -3’ (forward primer)
- lepR1 5’- TAAACTTCTGGATGTCCAAAAAATCA-3’(reverse primer)
- vf1f 5’- TCTCAACCAACCACAAAGACATTGG-3’ (forward primer)
- vf1r 5’- TAGACTTCTGGGTGGCCAAAGAATCA-3’ (reverse primer)