Skip to main content
Biology LibreTexts

13.2: Barcoding (Activity)

  • Page ID
    24863
  • \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\dsum}{\displaystyle\sum\limits} \)

    \( \newcommand{\dint}{\displaystyle\int\limits} \)

    \( \newcommand{\dlim}{\displaystyle\lim\limits} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \(\newcommand{\longvect}{\overrightarrow}\)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \(\newcommand{\ket}[1]{\left| #1 \right>}\)
    \(\newcommand{\bra}[1]{\left< #1 \right|}\)
    \(\newcommand{\braket}[2]{\left< #1 \vphantom{#2} \right| \left. #2 \vphantom{#1} \right>}\)
    \(\newcommand{\braopket}[3]{\left< #1 \vphantom{#2}\vphantom{#3} \right| #2 \vphantom{#1}\vphantom{#3} \left| #3 \vphantom{#1}\vphantom{#2} \right>}\)
    \(\newcommand{\qmvec}[1]{\mathbf{\vec{#1}}}\)
    \(\newcommand{\op}[1]{\hat{\mathbf{#1}}}\)
    \(\newcommand{\expect}[1]{\langle #1 \rangle}\)
    \(\newcommand{\dfn}[1]{\emph{\textbf{#1}}}\)

    \(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)

    DNA Barcoding of Samples

    1. Place sample in a clean 1.5 mL tube.
    2. Add 100 μl of nuclear lysis solution to tube.
    • Twist a clean plastic pestle against the inner surface.
    1. Add 500 μl more nuclear lysis solution to tube.
    2. Incubate the tube in a water bath or heat block at 65°C for 5-15 minutes.
    3. [Optional] Add 200 μl of protein precipitation solution to each tube incubate on ice for 5 minutes.
    4. Centrifuge for 4 minutes at maximum speed to pellet protein and cell debris.
    5. Transfer 600 μl of supernatant to a clean labeled tube.
    6. Add 600 μl of isopropanol.
    7. Centrifuge for 2 minutes at maximum speed to pellet the DNA.
    8. Pour off the supernatant and add 600 μl of 70% ethanol to wash the pellet.
    9. Centrifuge the tube for 2 minutes at maximum speed and carefully remove the solution.
    10. Air-dry the pellet for 10 minutes and add 100 μl of the DNA rehydration solution (TE).
    11. Incubate the DNA at 65°C for 5-10 minutes to dissolve.
    12. Obtain a PCR tube containing Ready-To-Go PCR Bead. Label the tube with your identification number.
    13. Use a micropipette with a fresh tip to add 23 μL of one of the following primer/loading dye mixes to each tube. Allow the beads to dissolve for 1 minute.
    • Plants: rbcL primers (rbcLaF / rbcLa rev)
    • Fish: COI primers (VF2_t1/ FishF2_t1/ FishR2_t1/ FR1d_t1)
    • Insects: (LepF1_t1/ LepR1_t1)
    1. Add 2 μl of your DNA directly into the appropriate primer/loading dye mix.
    2. Place tubes in a Thermal cycler.
    3. Pour 2% agarose into casting apparatus in the refrigerator.
      1. 2 gels per class needed to be made → 100ml of TBE with 2g agarose
      2. Add 5 μl SYBR safe solution into the molten agarose before casting.
      3. Place 2 sets of combs into the gel → at one end and in the middle.
    4. Load DNA ladder and PCR samples.
    5. Run the gel at 120V for 30 minutes.
    6. Visualize on the UV transilluminator.
    7. Document with a camera.
    8. Send amplicons of verified samples for sequencing.
    • Plant rbcL gene
      • rbcLaf 5’- ATGTCACCACAAACAGAGACTAAAGC-3’ (forward primer)
      • rbcLar 5’- GTAAAATCAAGTCCACCRCG-3’ (reverse primer)
    • Animal coi gene
      • lepF1 5’- ATTCAACCAATCATAAAGATATTGG -3’ (forward primer)
      • lepR1 5’- TAAACTTCTGGATGTCCAAAAAATCA-3’(reverse primer)
      • vf1f 5’- TCTCAACCAACCACAAAGACATTGG-3’ (forward primer)
      • vf1r 5’- TAGACTTCTGGGTGGCCAAAGAATCA-3’ (reverse primer)

    This page titled 13.2: Barcoding (Activity) was last modified on Sun, 03 Jan 2021 22:57:16 GMT and is shared under a CC BY-NC-SA 4.0 license and was authored, remixed, and/or curated by Bio-OER.

    • Was this article helpful?