13.2: Barcoding (Activity)
- Page ID
- 24863
\( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)
\( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)
\( \newcommand{\dsum}{\displaystyle\sum\limits} \)
\( \newcommand{\dint}{\displaystyle\int\limits} \)
\( \newcommand{\dlim}{\displaystyle\lim\limits} \)
\( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)
( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)
\( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)
\( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)
\( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)
\( \newcommand{\Span}{\mathrm{span}}\)
\( \newcommand{\id}{\mathrm{id}}\)
\( \newcommand{\Span}{\mathrm{span}}\)
\( \newcommand{\kernel}{\mathrm{null}\,}\)
\( \newcommand{\range}{\mathrm{range}\,}\)
\( \newcommand{\RealPart}{\mathrm{Re}}\)
\( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)
\( \newcommand{\Argument}{\mathrm{Arg}}\)
\( \newcommand{\norm}[1]{\| #1 \|}\)
\( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)
\( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)
\( \newcommand{\vectorA}[1]{\vec{#1}} % arrow\)
\( \newcommand{\vectorAt}[1]{\vec{\text{#1}}} % arrow\)
\( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)
\( \newcommand{\vectorC}[1]{\textbf{#1}} \)
\( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)
\( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)
\( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)
\( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)
\(\newcommand{\longvect}{\overrightarrow}\)
\( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)
\(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)DNA Barcoding of Samples
- Place sample in a clean 1.5 mL tube.
- Add 100 μl of nuclear lysis solution to tube.
- Twist a clean plastic pestle against the inner surface.
- Add 500 μl more nuclear lysis solution to tube.
- Incubate the tube in a water bath or heat block at 65°C for 5-15 minutes.
- [Optional] Add 200 μl of protein precipitation solution to each tube incubate on ice for 5 minutes.
- Centrifuge for 4 minutes at maximum speed to pellet protein and cell debris.
- Transfer 600 μl of supernatant to a clean labeled tube.
- Add 600 μl of isopropanol.
- Centrifuge for 2 minutes at maximum speed to pellet the DNA.
- Pour off the supernatant and add 600 μl of 70% ethanol to wash the pellet.
- Centrifuge the tube for 2 minutes at maximum speed and carefully remove the solution.
- Air-dry the pellet for 10 minutes and add 100 μl of the DNA rehydration solution (TE).
- Incubate the DNA at 65°C for 5-10 minutes to dissolve.
- Obtain a PCR tube containing Ready-To-Go PCR Bead. Label the tube with your identification number.
- Use a micropipette with a fresh tip to add 23 μL of one of the following primer/loading dye mixes to each tube. Allow the beads to dissolve for 1 minute.
- Plants: rbcL primers (rbcLaF / rbcLa rev)
- Fish: COI primers (VF2_t1/ FishF2_t1/ FishR2_t1/ FR1d_t1)
- Insects: (LepF1_t1/ LepR1_t1)
- Add 2 μl of your DNA directly into the appropriate primer/loading dye mix.
- Place tubes in a Thermal cycler.
- Pour 2% agarose into casting apparatus in the refrigerator.
- 2 gels per class needed to be made → 100ml of TBE with 2g agarose
- Add 5 μl SYBR safe solution into the molten agarose before casting.
- Place 2 sets of combs into the gel → at one end and in the middle.
- Load DNA ladder and PCR samples.
- Run the gel at 120V for 30 minutes.
- Visualize on the UV transilluminator.
- Document with a camera.
- Send amplicons of verified samples for sequencing.
- Plant rbcL gene
- rbcLaf 5’- ATGTCACCACAAACAGAGACTAAAGC-3’ (forward primer)
- rbcLar 5’- GTAAAATCAAGTCCACCRCG-3’ (reverse primer)
- Animal coi gene
- lepF1 5’- ATTCAACCAATCATAAAGATATTGG -3’ (forward primer)
- lepR1 5’- TAAACTTCTGGATGTCCAAAAAATCA-3’(reverse primer)
- vf1f 5’- TCTCAACCAACCACAAAGACATTGG-3’ (forward primer)
- vf1r 5’- TAGACTTCTGGGTGGCCAAAGAATCA-3’ (reverse primer)


