Skip to main content
Biology LibreTexts

1.12: DNA Biology

  1. Last updated
  2. Save as PDF
  • Page ID
    222598

    • \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\dsum}{\displaystyle\sum\limits} \)

    \( \newcommand{\dint}{\displaystyle\int\limits} \)

    \( \newcommand{\dlim}{\displaystyle\lim\limits} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \(\newcommand{\longvect}{\overrightarrow}\)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \(\newcommand{\ket}[1]{\left| #1 \right>}\)
    \(\newcommand{\bra}[1]{\left< #1 \right|}\)
    \(\newcommand{\braket}[2]{\left< #1 \vphantom{#2} \right| \left. #2 \vphantom{#1} \right>}\)
    \(\newcommand{\braopket}[3]{\left< #1 \vphantom{#2}\vphantom{#3} \right| #2 \vphantom{#1}\vphantom{#3} \left| #3 \vphantom{#1}\vphantom{#2} \right>}\)
    \(\newcommand{\qmvec}[1]{\mathbf{\vec{#1}}}\)
    \(\newcommand{\op}[1]{\hat{\mathbf{#1}}}\)
    \(\newcommand{\expect}[1]{\langle #1 \rangle}\)
    \(\newcommand{\dfn}[1]{\emph{\textbf{#1}}}\)

    \(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)

    Introduction

    Learning Objectives
    • Identify the structures of DNA and RNA
    • Compare and contrast DNA and RNA
    • Describe the processes of transcription and translation

    Our cells are constantly doing work, day and night. All of this work is spearheaded by one molecule -- Deoxyribonucleic Acid (or DNA for short.) DNA is a massive molecule consisting of repeating nucleotides in a double helix shape. These repeating nucleotides can have one of four different bases: adenine, thymine, cytosine, or guanine. It’s the unique combination of these four bases that allows DNA to encode all of the information for the cell.

    This figure shows the hierarchical packaging of DNA from a chromosome down to its nucleotide sequence. Chromosome: A blue, X-shaped chromosome at the top left. Chromatin: The chromosome material uncoiling into a condensed fiber loop. Nucleosomes & Histones: The fiber unraveling further to reveal a "beads-on-a-string" structure, where the DNA strand wraps around grey, spherical histone proteins to form nucleosomes. DNA Helix: The thin thread extending into a classic double-helix structure with colored base pairs. Nucleotide Sequence: The double helix opening at the bottom to show a flat, ladder-like diagram with two complementary strands of genetic code: Top strand (green text): ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA. Bottom strand (red text): TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT

    DNA Replication by OpenStax is licensed under CC BY 4.0

    The Structures of DNA and RNA

    DNA’s double helix shape is in part due to it having two nucleotide chains running parallel to each other, forming a ladder-like shape. The phosphate and deoxyribose sugars link together to form what are called the “backbones”, while the bases extend outward, forming the “rungs.” The two bases forming the rungs are not random though. Each base has only one other base that it can bond with: adenine and thymine always pair together while cytosine and guanine only pair with each other. This is called complementary base pairing. This gives us a predictable pattern so that knowing the bases from one side of the DNA molecule means you can easily figure out the other side. A close up of DNA’s structure can be seen below.

    A detailed diagram illustrating the chemical structure of DNA, divided into two main sections. Left side: A simplified 3D model of the DNA double helix showing the antiparallel strands labeled with 3' and 5' ends. The sugar-phosphate backbones form the outer spirals, and horizontal rungs represent base pairs. A color-coded legend identifies the nitrogenous bases: Adenine (red), Thymine (orange), Guanine (blue), and Cytosine (green). Right side: A detailed atomic-level chemical structure showing how the nucleotides connect and pair. The outer edges show the sugar-phosphate backbone, consisting of phosphate groups and deoxyribose sugar rings oriented in opposite directions (5' to 3' on the left, 3' to 5' on the right). The center section labeled Bases shows the specific hydrogen bonding between base pairs: a Thymine (orange) paired with an Adenine (pink) via two hydrogen bonds, and a Guanine (blue) paired with a Cytosine (green) via three hydrogen bonds.

    The Nucleus and DNA Replication by OpenStax is licensed under CC BY 4.0

    Let’s practice these complementary base pair rules. Complete the table using the appropriate base letter.

    Table 1 Base Pairing Rules

    STRAND #1

    STRAND #2
     

    T

    G

    		  

    A

    		  
     

    G

    T

    		  
     

    C

    DNA is not the only nucleotide important to the cell. RNA (ribonucleic acid) is also a necessary molecule, as it helps the cell read and use DNA’s instructions. RNA has a similar structure with a few key differences: it is single stranded and DNA’s thymine has been replaced with uracil. So, the base pair rules in RNA are A with U and C with G. There are three different types of RNA that we will look at in this class: rRNA, mRNA, and tRNA. Each RNA type can be seen in the table below. RNA compared to DNA is seen in the image below.

    Table 2 Types of RNA

    Type of RNA

    Full RNA Name

    Function

    rRNA

    Ribosomal RNA

    Forms part of the ribosome

    mRNA

    Messenger RNA

    Carries instructions from nucleus to ribosome

    tRNA

    Transfer RNA

    Transfers amino acids in translation

    This diagram compares the molecular structures of RNA and DNA. Left Side (RNA): Titled "RNA Ribonucleic acid", showing a single-stranded helix of sugar-phosphates with exposed individual nucleobases. To the far left the four nucleobases specific to RNA are illustrated with chemical diagrams and color-coded letter blocks: Cytosine (C, blue), Guanine (G, green), Adenine (A, yellow), and Uracil (U, orange). Right Side (DNA): Titled "DNA Deoxyribonucleic acid", showing a double-stranded helix structure bound together by horizontal base pairs. To the far right, the four nucleobases specific to DNA are illustrated with chemical diagrams and letter blocks: Cytosine (C, blue), Guanine (G, green), Adenine (A, yellow), and Thymine (T, red). Core Differences Highlighted Strand Structure: RNA is a single strand, while DNA is a double helix. Nitrogenous Bases: RNA utilizes Uracil (U), whereas DNA utilizes Thymine (T). Both share Cytosine (C), Guanine (G), and Adenine (A).

    File:Difference DNA RNA-DE.svg: Sponk / *translation: Sponk, CC BY-SA 3.0, via Wikimedia Commons

    Transcription and Translation

    Transcription and translation put DNA to work. DNA contains many smaller segments called genes -- sections of DNA that code for a protein. These genes cannot directly produce these proteins however, and so the cell must create temporary copies of these segments to use elsewhere in the cell.

    To transcribe quite literally means “to put into written or printed form.” This is a very close description as to what is happening in the cell. Since the DNA cannot directly make proteins, mechanisms are in place to read and transcribe DNA’s genes. Instead, mRNA is made by RNA polymerase, which reads the opened DNA strand. When RNA polymerase reads the DNA, it uses the complementary base pair rules to select the correct base for mRNA it’s building. Then, the mRNA molecule is released and leaves the nucleus.

    RNA polymerase needs direction on where and when to start the transcription process. Since the cells do not need to use every gene all the time, it’s important that there is a way to regulate when genes are used. The promoter is a special section of DNA that comes before the gene and helps dictate if a gene should be used often, sometimes, or hardly ever.

    The figure demonstrates how genomic information flows from a highly condensed chromosome down to an individual RNA transcript. Key Elements: Chromosomal Unwinding: At the top left, a blue chromosome unwinds into a long chromatin fiber, which gradually transitions into a double-helix DNA strand. Transcription Bubble: The double-stranded DNA opens up into a localized bubble structure at the bottom to allow transcription to take place. RNA Polymerase: A yellow, cloud-like molecule labeled "RNA polymerase" is shown moving along the unwound DNA template strand in the direction of an arrow. Molecular Sequences: The top DNA coding strand reads: A T G A C G G A T C A G C C G C A A G C G G G A A T T G G C G A C A T A A. The growing green "RNA Transcript" strand underneath reads: U A C U G C C U A G U C G G C G U U. The bottom DNA template strand reads: T A C T G C C T A G T C G G C G T T C G C C T T A A C C G C T G T A T T.

    OpenStax, CC BY 4.0, via Wikimedia Commons

    Table 3 Transcription Roles
    Role in Transcription
    Promoter Regulates when a gene will go through transcription
    RNA polymerase “Reads” DNA and builds the mRNA strand
    mRNA Carries the information from the transcribed gene
    DNA Encodes information in the form of genes to be read and used

    Translation puts the mRNA produced during transcription to work. The mRNA molecule leaves the nucleus and enters into the cytoplasm. We can describe translation in three steps.

    Initiation: Once in the cytoplasm, a ribosome will grab onto the mRNA.

    Elongation: The ribosome reads mRNA three bases at a time. These three bases are called a codon and dictate which amino acid is next in the sequence. This codon binds with the anticodon of tRNA in the ribosome, which brings the appropriate amino acid.

    Termination: When a STOP codon is reached, it causes the ribosome to let go of the mRNA molecule and protein strand.

    Now we will take RNA strands and translate it into a sentence.

    For this activity, transcribe the DNA strands below and identify the codons in the message. Then, look up the genetic code to identify the corresponding amino acids in the chain.

    1. DNA: T T T A G C C T A G C T A A A T T T C A G T G C
      • mRNA:
      • Protein:
    2. DNA: T T T T G A G G C G C T G T G T T T G T C
      • mRNA:
      • Protein:
    3. DNA: T T T C A G T T C C A A A A A T T T A G C C T T
      • mRNA:
      • Protein:
    4. DNA: T T T G G T A A T G G G G T A C A G T T G
      • mRNA:
      • Protein:
    5. DNA: T T T T T A A A G G G A G C T T G G G A G T T T T G C
      • mRNA:
      • Protein:
    6. DNA: T A A G A T G T A A G C A A C C C T
      • mRNA:
      • Protein:
    7. DNA: T A A A G G C C G A A C G T T
      • mRNA:
      • Protein:
    8. DNA: C A G G A A T G T T A G C C A T C T
      • mRNA:
      • Protein:
    9. DNA: T A A A G G A C C T C G
      • mRNA:
      • Protein:
    10. DNA: T T T T G A G G C G C T C G C T T T C A G C G A
      • mRNA:
      • Protein:
    11. DNA: T A A A G G A C C A A G T C C C G T
      • mRNA:
      • Protein:
    12. DNA: T A A C G G G T A G G T A A T
      • mRNA:
      • Protein:
    13. DNA: T T T A G C C T A T A T T T T T G A C T A
      • mRNA:
      • Protein:
    14. DNA: T T T A A C A A T T A C T C A T T T T G C
      • mRNA:
      • Protein:

    "Protein Synthesis Activity" by Aimee Mazzoni, Reedley College is licensed under CC BY 4.0

    DNA Extraction

    DNA may be stored away inside the nucleus of every cell, but that does not mean that it is inaccessible. We can access the DNA if we can get past the plasma membrane. Remember that the membrane is lipid-based, so chemicals that break down lipids are the best bet to releasing the DNA. For this exercise, we will extract DNA from strawberry, although any living thing can be used, such as strawberries or your own saliva. In fact, this experiment can be replicated in your own kitchen.

    What do you think DNA will look like when extracted?

    Materials:

    • 1 set of mortar and pestle
    • 2 medium size strawberries or 1 large strawberry (store bought)
    • 100 ml saline
    • 5 ml of dish soap
    • 1 stirring rod
    • Ethanol, ice cold
    • Test tubes
    • Falcon tubes
    • Test Tube racks

    Procedure:

    1. Obtain a clean test tube.
    2. Add 1-2 strawberries and add to the test tube.
    3. Add enough saline to fully saturate and cover the strawberry.
    4. Add 3-5 drops of dish soap.
    5. Use the pestle to grind the strawberry in the saline and form a homogeneous mixture
    6. Slowly stir the contents of the tube with the stirring rod, carefully avoiding making bubbles, for at least 5 minutes.
    7. Set up a falcon tube with a funnel and cheese cloth, filter the strawberry liquid into the falcon tube
    8. Discard the strawberry debris collected in the cheese cloth
    9. Add 1 mL of ice-cold ethanol to the falcon tube on the side by tilting the tube at a 45° angle and slowly dripping the ethanol down the side of the tube. This will create a layer of ethanol floating over the top of your strawberry slurry.
    10. Set the tube aside for 3-5 minutes. The DNA will precipitate up into the ethanol as a white stringy material.
    11. Collect the DNA using a glass rod into a clean falcon tube or test tube and add few drops of pH indicator.
    12. A phenol red pH indicator will change color to yellow to indicate an acidic pH in the presence of DNA.

    Clean-up:

    1. Dump the strawberry solids in the trash.
    2. Wash the tubes in the sink and return to the test tube rack.

    When the DNA precipitated into the ethanol, how did it look?

    Why do you think dish soap was added to extract the DNA? Hint: Consider what cell structure serves as a barrier.


    Consider the fact that the procedure called for the ethanol to be poured so that it floated over the top of the strawberry slurry. How do you think DNA’s visibility would change if the ethanol mixed with the slurry?


    Set Up of the DNA Extraction

    A clear plastic Falcon tube containing strawberry liquid sits upright on a lab bench. A funnel is placed in the top of the tube, lined with white cheesecloth. Inside the cheesecloth at the top of the funnel are pieces of mashed red strawberries used in the DNA extraction experiment.
    Figure A: DNA Extraction using cheesecloth. (By SB)
    A clear plastic Falcon tube containing a layered strawberry liquid mixture. The bottom portion of the tube is filled with the strawberry liquid, while a clear, translucent liquid layer sits directly on top of it. The top layer contains the stringy DNA.
    Figure B: View of the extracted DNA in the top layer. (By SB)

    Licensing and Attributions

    1.12: DNA Biology is shared under a CC BY-NC-SA 4.0 license and was authored, remixed, and/or curated by LibreTexts.