Skip to main content

Registration is now open for this year's LibreFest! Join us virtually the week of July 13.

Register here
Biology LibreTexts

10.E: Molecular Markers and Quantitative Traits (Exercises)

  • Page ID
    4136
  • \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\dsum}{\displaystyle\sum\limits} \)

    \( \newcommand{\dint}{\displaystyle\int\limits} \)

    \( \newcommand{\dlim}{\displaystyle\lim\limits} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \(\newcommand{\longvect}{\overrightarrow}\)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)

    These are homework exercises to accompany Nickle and Barrette-Ng's "Online Open Genetics" TextMap. Genetics is the scientific study of heredity and the variation of inherited characteristics. It includes the study of genes, themselves, how they function, interact, and produce the visible and measurable characteristics we see in individuals and populations of species as they change from one generation to the next, over time, and in different environments.

    Study Questions:

    10.1 Three different polymorphisms have been identified at a particular molecular marker locus. A single pair of PCR primers will amplify either a 50bp fragment (B2), a 60bp fragment (B3), or a 100bp fragment (B4).

    Draw the PCR bands that would be expected if these primers were used to amplify DNA from individuals with each of the following genotypes:

    a) B2B2

    b) B4B4

    c) B2B3

    d) B2B4

    10.2 In addition to the primers used to genotype locus B (described above), a separate pair of primers can amplify another polymorphic SSR locus E, with either a 60bp product (E1) or a 90bp (E2) product. DNA was extracted from six individuals (#1- #6), and DNA from each individual was used as a template in separate PCR reactions with primers for either locus B or primers for locus E, and the PCR products were visualized on electrophoretic gels as shown below.

    Based on the following PCR banding patterns, what is the full genotype of each of the six individuals?

    Q10.2.png

    10.3 Based on the genotypes you recorded in Question 10.2, can you determine which of the individuals could be a parent of individual #1?

    10.4 Here is part of the DNA sequence of a chromosome:

    TAAAGGAATCAATTACTTCTGTGTGTGTGTGTGTGTGTGTGTGTTCTTAGTTGTTTAAGTTTTAAGTTGTGA

    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

    ATTTCCTTAGTTAATGAAGACACACACACACACACACACACACAAGAATCAACAAATTCAAAATTCAACACT

    Identify the following features on the sequence:

    a) the region of the fragment that is most likely to be polymorphic

    b) any simple sequence repeats

    c) the best target sites for PCR primers that could be used to detect polymorphisms in the length of the simple sequence repeat region in different individuals

    10.5 In a particular diploid plant, seed color is a polygenic trait. If true-breeding plants that produce red seeds are crossed with true breeding plants that produce white seeds, the F1 produces seeds that are intermediate in color (i.e. pink). When an F1 plant self-fertilizes, white seeds are observed in the next generation. How many genes are involved in seed color for each of the following frequencies of white seeds in the F2 generation?

    a) 1/4 white seeds

    b) 1/16 white seeds

    c) 1/64 white seeds

    d) 1/256 white seeds

    10.6 If height in humans is a polygenic trait, explain why it occasionally happens that two tall parents have a child who grows up to be much shorter than either of them.

    10.7 In quantitative trait (QTL) mapping, researchers cross two parents that differ in expression of some quantitative trait, then allow chromosomes from these parents to recombine randomly, and after several generations of inbreeding, produce a large number of offspring (“recombinant inbred lines”). Because the position of crossovers is random, each of the offspring contain a different combination of chromosomal regions from each of the two parents. The researchers then use molecular markers to determine which chromosomal regions have the greatest influence on the quantitative trait, e.g. in tall offspring, which chromosomal regions always come from the tall parent?

    Imagine that two mice strains have been identified that differ in the time required to complete a maze, which may be an indication of intelligence. The time for maze completion is heritable and these parental strains “breed true” for the same completion time in each generation. Imagine also that their chromosomes are different colors and we can track the inheritance of chromosomal regions from each parent based on this color.

    Based on the following diagrams of one chromosome from each individual in a pedigree, identify a chromosomal region that may contain a gene that affects time to complete a maze. The time for each individual is shown below each chromosome. Assume that all individuals are homozygous for all loci.

    Parents:

    Q10.7_parents.png

    Selected individuals from among F8 progeny of the above parents:

    Q10.7_progeny.png

    10.8 In a more realistic situation (as compared to question 7), where you could not distinguish the parental origin of different chromosomal regions just by appearance of chromosomes, explain how you could identify which parent was the source of a particular region of a chromosome in recombinant offspring.


    This page titled 10.E: Molecular Markers and Quantitative Traits (Exercises) is shared under a CC BY-SA 3.0 license and was authored, remixed, and/or curated by Todd Nickle and Isabelle Barrette-Ng via source content that was edited to the style and standards of the LibreTexts platform.