Skip to main content

Registration is now open for this year's LibreFest! Join us virtually the week of July 13.

Register here
Biology LibreTexts

8.2: The Stuff of Genes

  • Page ID
    16458
  • \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\dsum}{\displaystyle\sum\limits} \)

    \( \newcommand{\dint}{\displaystyle\int\limits} \)

    \( \newcommand{\dlim}{\displaystyle\lim\limits} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \(\newcommand{\longvect}{\overrightarrow}\)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)

    That all eukaryotic cells contain a nucleus was understood by the late 19th century. By then, histological studies had shown that nuclei contained largely proteins and DNA. At around the same time, the notion that the nucleus contains genetic information was gaining traction. In 1910, Albrecht Kossel received the 1910 Nobel Prize in Physiology or Medicine for his discovery of the adenine, thymine, cytosine and guanine (the four DNA bases), as well as of uracil in RNA. Mendel’s Laws of Inheritance, presented in 1865, were not widely understood, probably because they relied on a strong dose of arithmetic and statistics, when the utility of quantitative biology was not much appreciated. But, following the re-discovery three decades later, the number of known inherited traits in any given organism increased rapidly. At that time, DNA was known as a small, simple molecule, made up of only the four nucleotides (see DNA Structure below for additional historical perspective). So, the question was how could such a small, simple account for the inheritance of so many different physical traits? The recognition that enzyme activities were inherited in the same way as morphological characteristics led to the one- gene-one enzyme hypothesis that earned G. W. Beadle, E. L. Tatum and J. Lederberg the 1958 Nobel Prize for Physiology and Medicine. When enzymes were later shown to be proteins, the hypothesis became one-gene-one protein. When proteins were shown to be composed of one or more polypeptides, the final hypothesis became one-gene-one- polypeptide. However, this relationship between genes and proteins failed to shed any light on how DNA might be the genetic material. In fact, quite the contrary! As chains of up to 20 different amino acids, polypeptides and proteins had the potential for enough structural diversity to account for the growing number of heritable traits in a given organism. Thus, proteins seemed more likely candidates for the molecules of inheritance.

    The experiments you will read about here began around the start of World War I and lasted until just after World War 2. During this time, we learned that DNA was no mere tetramer, but was in fact a long polymer. This led to some very clever experiments that eventually forced the scientific community to the conclusion that DNA, not protein, was the genetic molecule, despite being composed of just four monomeric units. Finally, we look at the classic work of Watson, Crick, Franklin and Wilkins that revealed the structure of the genetic molecule.

    A. Griffith’s Experiment

    Fred Neufeld, a German bacteriologist studying pneumococcal bacteria in the early 1900s discovered three immunologically different strains of Streptococcus pneumonia (Types I, II and III). The virulent strain (Type III) was responsible for much of the mortality during the Spanish Flu (influenza) pandemic of 1918-1920. This pandemic killed between 20 and 100 million people, many because the influenza viral infection weakened the immune system of infected individuals, making them susceptible to bacterial infection by Streptococcus pneumonia.

    In the 1920s, Frederick Griffith was working with virulent wild type (Type III) and benign (Type II) strains of S. pneumonia. The two strains were easy to tell apart petri dishes because the virulent strain grew in morphologically smooth colonies, while the benign strain formed rough colonies. For this reason, the two bacterial strains were called S and R, respectively. We now know that S cells are coated with a polysaccharide (mucus) capsule, making colonies appear smooth. In contrast, R cell colonies look rough (don’t glisten) because they lack the polysaccharide coating.

    Griffith knew that injecting mice with S cells killed them within about a day! Injecting the non-lethal R cells on the other hand, caused no harm. Then, he surmised that, perhaps, the exposure of mice to the R strain of S. pneumonia first would immunize them against lethal infection by S cells. His experimental protocol and results, published in 1928, are summarized below.

    clipboard_eca9fe04accac7764a3d1a807dbfa70bb.png

    To test his hypothesis, Griffith injected mice with R cells. Sometime later, he injected them with S cells. However, the attempt to immunize the mice against S. pneumonia was unsuccessful! The control mice injected with S strain cells and the experimental mice that received the R strain cells first and then S cells, all died in short order! As expected, mice injected with R cells only survived.

    Griffith also checked the blood of his mice for the presence of bacterial cells:

    · Mice injected with benign R (rough) strain cells survived and after plating blood from the mice on nutrient medium, no bacterial cells grew.

    · Many colonies of S cells grew from the blood of dead mice injected with S cells.

    Griffith performed two other experiments, shown in the illustration:

    1. He injected mice with heat-killed S cells; as expected, these mice survived. Blood from these mice contained no bacterial cells. This was “expected” since heating the S cells should have the same effect as pasteurization has on bacteria in milk!

    2. Griffith also injected mice with a mixture of live R cells and heat-killed S cells, in the hope that the combination might induce immunity in the mouse where injecting the R cells alone had failed. You can imagine his surprise when, far from becoming immunized, the injected mice died and abundant S cells had accumulated in their blood.

    Griffith realized that something important had happened in his experiments. In the mixture of live R cells and heat-killed S cells, something released from the dead S cells had transformed some R cells. Griffith named this “something” the transforming principle, a molecule present in the debris of dead S cells and sometimes acquired by a few live R cells, turning them into virulent S cells. We now know that R cells lack polysaccharide coat, and that the host cell’s immune system can attack and clear R cells before a serious infection can take hold.

    B. The Avery-MacLeod-McCarty Experiment

    Griffith didn’t know the chemical identity of the transforming principle. However, his experiments led to studies that proved DNA was the “stuff of genes”. With improved molecular purification techniques developed in the 1930s, O. Avery, C. MacLeod, and M. McCarty transformed R cells in vitro (that is, without the help of a mouse!). They purified heat-killed S-cell components (DNA, proteins, carbohydrates, lipids…) and separately tested the transforming ability of each molecular component on R cells in a test tube.

    The experiments of Avery et al. are summarized below.

    clipboard_ea1eb5453448f9f5dd53193f67a83701d.png

    Since only the DNA fraction of the dead S cells could cause transformation, Avery et al. concluded that DNA must be the Transforming Principle. In spite of these results, DNA was not readily accepted as the stuff of genes. The sticking point was that DNA was composed of only four nucleotides. Even though scientists knew that DNA was a large polymer, they still thought of DNA as that simple molecule, for example a polymer made up of repeating sequences of the four nucleotides:

    …AGCTAGCTAGCTAGCTAGCT…

    Only the seemingly endless combinations of 20 amino acids in proteins promised the biological specificity necessary to account for an organism’s many genetic traits. Lacking structural diversity, DNA was explained as a mere scaffold for protein genes. To adapt Marshal McLuhan’s famous statement that the medium is the message (i.e., airwaves do not merely convey, but are the message), many still believed that proteins are the medium of genetic information as well as the functional message itself.

    The reluctance of influential scientists of the day to accept a DNA transforming principle deprived its discoverers of the Nobel Prize stature it deserved. After new evidence made further resistance to that acceptance untenable, even the Nobel Committee admitted that failure to award a Nobel Prize for the discoveries of Avery et al. was an error. The key experiments of Alfred Hershey and Martha Chase finally put to rest any notion that proteins were genes.

    167 Transformation In & Out of Mice; Griffith, McCarthy et al.

    C. The Hershey-Chase Experiment

    Biochemically, bacterial viruses were known consist of DNA enclosed in a protein capsule. The life cycle of bacterial viruses (bacteriophage, or phage for short) begins with infection of a bacterium, as illustrated below.

    clipboard_eb38cf31ac6d5a00c6f3cb077ab998f7d.png

    Phages are inert particles until they bind to and infect bacterial cells. Phage particles added to a bacterial culture could be seen attach to bacterial surfaces in an electron microscope. Investigators found that they could detach phage particles from bacteria by agitation in a blender (similar to one you might have in your kitchen). Centrifugation then separated the bacterial cells in a pellet at the bottom of the centrifuge tube, leaving the detached phage particles in the supernatant. By adding phage to bacteria and then detaching the phage from the bacteria at different times, it was possible to determine how long it the phage had to remain attached before the bacteria become infected. It turned out that pelleted cells that had been attached to phage for short times would survive and reproduce when re-suspended in growth medium. But pelleted cells left attached to phage for longer times had become infected; centrifugally separated from the detached phage and resuspended in fresh medium, these cells would go on and lyse, producing new phage. Therefore, the transfer of genetic information for virulence from virus to phage took some time. The viral genetic material responsible for infection and virulence was apparently no longer associated with the phage capsule, which could be recovered from the centrifugal supernatant.

    Alfred Hershey and Martha Chase designed an experiment to determine whether the DNA enclosed by the viral protein capsule or the capsule protein itself caused phage to infect the bacterium. In the experiment, they separately grew E. coli cells infected with T2 bacteriophage in the presence of either 32P or 35S (radioactive isotopes of phosphorous and sulfur, respectively). The result was to produce phage that contained either radioactive DNA or radioactive proteins, but not both (recall that only DNA contains phosphorous and only proteins contain sulfur). They then separately infected fresh E. coli cells with either 32P- or 35S-labeled, radioactive phage. Their experiment is described below.

    clipboard_ede677d928e89f1b2026f3b286871826f.png

    Phage and cells were incubated with either 32P or 35S just long enough to allow infection. Some of each culture was allowed to go on and lyse to prove that the cells were infected. The remainder of each mixture was sent to the blender. After centrifugation of each blend, the pellets and supernatants were examined to see where the radioactive proteins or DNA had gone. From the results, the 32P always ended up in the pellet of bacterial cells while the 35S was found in the phage remnant in the supernatant. Hershey and Chase concluded that the genetic material of bacterial viruses was DNA and not protein, just as Avery et al. had suggested that DNA was the bacterial transforming principle.

    Given the earlier resistance to “simple” DNA being the genetic material, Hershey and Chase used cautious language in framing their conclusions. They need not have; all subsequent experiments confirmed that DNA was the genetic material. Concurrent with these confirmations were experiments demonstrating that DNA might not be (indeed, was not) such a simple, uncomplicated molecule! For their final contributions to pinning down DNA as the “stuff of genes”, Alfred D. Hershey shared the 1969 Nobel Prize in Physiology or Medicine with Max Delbruck and Salvador E. Luria.

    168 Hershey and Chase: Viral Genes are in Viral DNA


    This page titled 8.2: The Stuff of Genes is shared under a CC BY license and was authored, remixed, and/or curated by Gerald Bergtrom via source content that was edited to the style and standards of the LibreTexts platform.

    • Was this article helpful?