Skip to main content
[ "article:topic", "showtoc:no", "license:ccbysa", "authorname:burrananddesrochers" ]
Biology LibreTexts

Part 5: Coding Practice

  • Page ID
    16634
  • Coding Practice

    1. Use this sequence of DNA to answer the following former test questions:

        5’-- TTAATGGGACAGCTTGTGTAGAGG --3’

    a. What is the complementary strand of DNA?

     

    b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence?

     

    c. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)?
    Remember:

    i. Start codon!

    ii. Stop codon!

    85.png

    Additional Images from: 

    http://www.descrittiva.it/calip/dna/dna03.jpg http://history.nih.gov/exhibits/nire...File:Ribosome_ mRNA_translation_en.svg